scf45d, scf45d (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf45d
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ct)14
Primer 1scf45d.forward primer: TTCTTGTGGTTGTGCTGCAT
Primer 2scf45d.reverse primer: TAATGGCTGAAACGCTCACA
Max Length288
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG9N/A91.52scf45dViewN/A
2Cranberry-Mullica_Queen-2017LG09N/A102.8scf45dViewN/A
3Cranberry-Crimson_Queen-2017LG09N/A70.7scf45dViewN/A
4Cranberry-Mullica_Queen-2007LG9N/A110.8scf45dViewN/A
5Cranberry-Mullica_Queen_1-F1LG09N/A0scf45dViewN/A
6Cranberry-Unifiedmap2013LG1N/A0scf45dViewN/A
7Cranberry-Crimson_Queen-F1LG09N/A0scf45dViewN/A
8Cranberry-Crimson_Queen-2007LG9N/A80.3scf45dViewN/A
9Cranberry-CNJ02-1-2017LG09N/A85.3scf45dViewN/A
10Cranberry-Composite_map-F1LG09N/A1.13scf45dViewN/A
11Cranberry-BB/CQ-F1LG01N/A4.56scf45dViewN/A
12Cranberry-BB/CQ-F1LG01N/A2.16scf45dViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf45d.forward primerVaccinium macrocarponprimer
reverse primerscf45d.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
field fruit rot resistanceqFFRR.Unifiedmap2013.LG1Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf45dscf45dVaccinium macrocarponmarker_locus
scf45dscf45d-1.13Vaccinium macrocarponmarker_locus
scf45dscf45d-4.557Vaccinium macrocarponmarker_locus
scf45dscf45d-2.159Vaccinium macrocarponmarker_locus