scf45d, scf45d (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf45d
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ct)14
Primer 1scf45d.forward primer: TTCTTGTGGTTGTGCTGCAT
Primer 2scf45d.reverse primer: TAATGGCTGAAACGCTCACA
Max Length288
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr06supercontigVcev1_p0.Chr06:52999790..52999978 .
scaffold00002supercontigscaffold00002:346101..346289 .
chr6_H1supercontigchr6_H1:44107113..44107303 .
Vmac_chr09supercontigVmac_chr09:40171264..40171508 .
Chr06supercontigChr06:1329881..1330089 .
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG9N/A91.52scf45dView
2Cranberry-Crimson_Queen-2007LG9N/A80.3scf45dView
3Cranberry-Mullica_Queen-2007LG9N/A110.8scf45dView
4Cranberry-Unifiedmap2013LG1N/A0scf45dView
5Cranberry-Crimson_Queen-F1LG09N/A0scf45dView
6Cranberry-Mullica_Queen_1-F1LG09N/A0scf45dView
7Cranberry-CNJ02-1-2017LG09N/A85.3scf45dView
8Cranberry-Crimson_Queen-2017LG09N/A70.7scf45dView
9Cranberry-Mullica_Queen-2017LG09N/A102.8scf45dView
10Cranberry-Composite_map-F1LG09N/A1.13scf45dView
11Cranberry-BB/CQ-F1LG01N/A4.56scf45dView
12Cranberry-BB/CQ-F1LG01N/A2.16scf45dView