SCF5230, SCF5230 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF5230
Genbank ID	KP278963
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)11
Primer 1	SCF5230.forward primer: TTCAAGATGCCTAAACCAGT
Primer 2	SCF5230.reverse primer: GTATAGTGGAGAAGAAGGGTGA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278963

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr02	supercontig	Vmac_chr02:2270483..2270750 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr2	supercontig	chr2:2578850..2579118 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.