SCF55751, SCF55751 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF55751
Genbank ID	KP278730
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)10
Primer 1	SCF55751.forward primer: ACTCACGTCCATTTTCTCAC
Primer 2	SCF55751.reverse primer: AGCGATATAACAATACCAGAGC
Max Length	239
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278730

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:36351767..36351980 .
chr8	supercontig	chr8:33682168..33682379 .
Chr04	supercontig	Chr04:34884120..34884344 .