SCF55751, SCF55751 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF55751
Genbank ID	KP278730
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)10
Primer 1	SCF55751.forward primer: ACTCACGTCCATTTTCTCAC
Primer 2	SCF55751.reverse primer: AGCGATATAACAATACCAGAGC
Max Length	239
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278730

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr08	supercontig	Vmac_chr08:36351767..36351980 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr8	supercontig	chr8:33682168..33682379 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences
Chr04	supercontig	Chr04:34884120..34884344 .	Vaccinium myrtillus isolate NK2018 v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.