scf6213, scf6213 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf6213
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf6213.forward primer: GCTCGCTCTCGCATATTTTC
Primer 2scf6213.reverse primer: CCTAGCCCGTTCATCATTGT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2017LG12N/A0.9scf6213ViewN/A
2Cranberry-CNJ02-1-2017LG12N/A2.6scf6213ViewN/A
3Cranberry-Stevens-F1LG12N/A61.69scf6213ViewN/A
4Cranberry-Mullica_Queen-2017LG12N/A5scf6213ViewN/A
5Cranberry-CNJ02-1-2007LG12N/A11.17scf6213ViewN/A
6Cranberry-Mullica_Queen-2007LG12N/A14.7scf6213ViewN/A
7Cranberry-Crimson_Queen-2007LG12N/A10.8scf6213ViewN/A
8Cranberry-Unifiedmap2013LG6N/A36.6scf6213ViewN/A
9Cranberry-Composite_map-F1LG12N/A77.11scf6213ViewN/A
10Cranberry-Crimson_Queen-F1LG12N/A56.74scf6213ViewN/A
11Cranberry-Mullica_Queen_1-F1LG12N/A89.64scf6213ViewN/A
12Cranberry-Mullica_Queen_2-F1LG12N/A64.76scf6213ViewN/A
13Cranberry-BB/CQ-F1LG06N/A11.51scf6213ViewN/A
14Cranberry-BB/CQ-F1LG06N/A11.1scf6213ViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf6213.forward primerVaccinium macrocarponprimer
reverse primerscf6213.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf6213scf6213Vaccinium macrocarponmarker_locus
scf6213scf6213-77.11Vaccinium macrocarponmarker_locus
scf6213scf6213-56.74Vaccinium macrocarponmarker_locus
scf6213scf6213-89.64Vaccinium macrocarponmarker_locus
scf6213scf6213-64.76Vaccinium macrocarponmarker_locus
scf6213scf6213-61.69Vaccinium macrocarponmarker_locus
scf6213scf6213-11.509Vaccinium macrocarponmarker_locus
scf6213scf6213-11.101Vaccinium macrocarponmarker_locus