scf6955c, scf6955c (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf6955c
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf6955c.forward primer: ATGCCTGCCATTCATCATTT
Primer 2scf6955c.reverse primer: TTTCCGTCATTTCGTCCTTC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2017LG04N/A16scf6955cViewN/A
2Cranberry-CNJ02-1-2007LG4N/A44.07scf6955cViewN/A
3Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG4N/A45.77scf6955cViewN/A
4Cranberry-Mullica_Queen-2007LG4N/A48.6scf6955cViewN/A
5Cranberry-Mullica_Queen-2017LG04N/A49.5scf6955cViewN/A
6Cranberry-Crimson_Queen-2007LG4N/A39.2scf6955cViewN/A
7Cranberry-CNJ02-1-2017LG04N/A48.4scf6955cViewN/A
8Cranberry-Unifiedmap2013LG2N/A49.5scf6955cViewN/A
9Cranberry-[BG//BL/BN]95-F1LG04N/A34.01scf6955cViewN/A
10Cranberry-Composite_map-F1LG04N/A29.89scf6955cViewN/A
11Cranberry-Crimson_Queen-F1LG04N/A35.71scf6955cViewN/A
12Cranberry-Mullica_Queen_1-F1LG04N/A53.09scf6955cViewN/A
13Cranberry-BB/CQ-F1LG02N/A40.21scf6955cViewN/A
14Cranberry-BB/CQ-F1LG02N/A51.87scf6955cViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf6955c.forward primerVaccinium macrocarponprimer
reverse primerscf6955c.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf6955cscf6955cVaccinium macrocarponmarker_locus
scf6955cscf6955c-34.01Vaccinium macrocarponmarker_locus
scf6955cscf6955c-29.89Vaccinium macrocarponmarker_locus
scf6955cscf6955c-35.71Vaccinium macrocarponmarker_locus
scf6955cscf6955c-53.09Vaccinium macrocarponmarker_locus
scf6955cscf6955c-40.208Vaccinium macrocarponmarker_locus
scf6955cscf6955c-51.866Vaccinium macrocarponmarker_locus