scf9e, scf9e (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf9e
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf9e.forward primer: TCACAGCGGAGAAGTTGATG
Primer 2scf9e.reverse primer: ATTTGCGAATCAACCCAAAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG5N/A67.28scf9eViewN/A
2Cranberry-CNJ02-1-2017LG05N/A63scf9eViewN/A
3Cranberry-Unifiedmap2013LG10N/A18.7scf9eViewN/A
4Cranberry-Crimson_Queen-2007LG5N/A62.7scf9eViewN/A
5Cranberry-Mullica_Queen-2017LG05N/A60.6scf9eViewN/A
6Cranberry-Mullica_Queen-2007LG5N/A74.1scf9eViewN/A
7Cranberry-Crimson_Queen-2017LG05N/A65.4scf9eViewN/A
8Cranberry-Composite_map-F1LG05N/A58.41scf9eViewN/A
9Cranberry-Crimson_Queen-F1LG05N/A53.67scf9eViewN/A
10Cranberry-GH1/35-F1LG05N/A58.64scf9eViewN/A
11Cranberry-Mullica_Queen_1-F1LG05N/A68.62scf9eViewN/A
12Cranberry-Mullica_Queen_2-F1LG05N/A57.08scf9eViewN/A
13Cranberry-Stevens-F1LG05N/A56.64scf9eViewN/A
14Cranberry-BB/CQ-F1LG10N/A70.67scf9eViewN/A
15Cranberry-BB/CQ-F1LG10N/A11.38scf9eViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf9e.forward primerVaccinium macrocarponprimer
reverse primerscf9e.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf9escf9eVaccinium macrocarponmarker_locus
scf9escf9e-58.41Vaccinium macrocarponmarker_locus
scf9escf9e-53.67Vaccinium macrocarponmarker_locus
scf9escf9e-58.64Vaccinium macrocarponmarker_locus
scf9escf9e-68.62Vaccinium macrocarponmarker_locus
scf9escf9e-57.08Vaccinium macrocarponmarker_locus
scf9escf9e-56.64Vaccinium macrocarponmarker_locus
scf9escf9e-70.669Vaccinium macrocarponmarker_locus
scf9escf9e-11.384Vaccinium macrocarponmarker_locus