KAN1151, KAN1151 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN1151
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN1151.Forward Primer: TCCATCTGACTGGGGATTTC
Primer 2	KAN1151.Reverse Primer: AACAAACAAGCAGGGATTGC
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr03	supercontig	Vcev1_p0.Chr03:52994097..52994283 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
scaffold00065	supercontig	scaffold00065:189027..189213 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.