KAN2584, KAN2584 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN2584
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN2584.Forward Primer: TTCTATGGTCAAACCCAGCC
Primer 2	KAN2584.Reverse Primer: CCAAAGCACCAAAAGAAGGA
Publication	[view all]

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Jewel	LG3b	N/A	48	KAN-2584	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr02	supercontig	Vcev1_p0.Chr02:33101368..33101543 .
scaffold01390	supercontig	scaffold01390:60637..60813 .
chr2_H1	supercontig	chr2_H1:29216965..29217106 .
Vmac_chr01	supercontig	Vmac_chr01:26307601..26307738 .
chr1	supercontig	chr1:23010840..23010977 .
Chr02	supercontig	Chr02:24359310..24359510 .
Chr02_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr02_Vaccinium_vitis-idaea_ssp_minus:28535637..28535849 .