|
Marker Overview
Name | KAN2584 |
Genbank ID | N/A |
Type | SSR |
Species | Vaccinium corymbosum |
Primer 1 | KAN2584.Forward Primer: TTCTATGGTCAAACCCAGCC |
Primer 2 | KAN2584.Reverse Primer: CCAAAGCACCAAAAGAAGGA |
Publication | [view all] |
Alignments
The following features are aligned
Publications
Year | Publication |
2016 | McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24. |
|