Pr032475737, Pr032475737 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr032475737
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr032475737.Forward Primer: AAGTCTCCCTCCCTCATTTG
Primer 2	Pr032475737.Reverse Primer: CTGTTAAGAAGCCAGCCAAC
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr3_H1	supercontig	chr3_H1:45615870..45616058 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences
Vmac_chr04	supercontig	Vmac_chr04:36502336..36502541 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
scaffold00313	supercontig	scaffold00313:102216..102429 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG4	N/A	98	Pr032475737c	View
2	Blueberry-Jewel	LG1	N/A	113	Pr032475737b	View
3	Blueberry-Jewel	LG1	N/A	122	Pr032475737a	View