Pr032605975, Pr032605975 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr032605975
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr032605975.Forward Primer: CGGACGTCTGATTCTCTCTC
Primer 2	Pr032605975.Reverse Primer: GGTCTTTGATGGAAACCTGA
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr10	supercontig	Vcev1_p0.Chr10:43834326..43834536 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
VaccDscaff20	supercontig	VaccDscaff20:30109960..30110162 .	Vaccinium corymbosum cv. Draper v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr10_H1	supercontig	chr10_H1:35254463..35254665 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG2	N/A	51	Pr032605975c	View
2	Blueberry-Draper	LG2	N/A	59	Pr032605975a	View
3	Blueberry-Draper	LG2	N/A	61	Pr032605975b	View