Pr032754267, Pr032754267 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr032754267
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr032754267.Forward Primer: AAACACCAAGCAGCAATACC
Primer 2	Pr032754267.Reverse Primer: GTCCGCTGCTGATTTCAT
Publication	[view all]

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG10	N/A	131	Pr032754267b	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr11	supercontig	Vcev1_p0.Chr11:52485072..52485261 .
VaccDscaff33	supercontig	VaccDscaff33:871022..871205 .
scaffold00244	supercontig	scaffold00244:204208..204397 .
chr11_H1	supercontig	chr11_H1:45971114..45971303 .