Pr032754267, Pr032754267 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr032754267
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr032754267.Forward Primer: AAACACCAAGCAGCAATACC
Primer 2	Pr032754267.Reverse Primer: GTCCGCTGCTGATTTCAT
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vcev1_p0.Chr11	supercontig	Vcev1_p0.Chr11:52485072..52485261 .	Vaccinium caesariense clone W85-20 P0 v2.0 genome sequence	GDV marker alignment to genome using primer sequences
VaccDscaff33	supercontig	VaccDscaff33:871022..871205 .	Vaccinium corymbosum cv. Draper v1.0 genome sequence	GDV marker alignment to genome using primer sequences
scaffold00244	supercontig	scaffold00244:204208..204397 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences
chr11_H1	supercontig	chr11_H1:45971114..45971303 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Draper	LG10	N/A	131	Pr032754267b	View