Pr032754272, Pr032754272 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr032754272
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr032754272.Forward Primer: CAAAATTTCCAGCATCCATC
Primer 2	Pr032754272.Reverse Primer: ATTTGTGGCTAGGGTTTGTG
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold00024	supercontig	scaffold00024:230910..231100 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences
chr12_H1	supercontig	chr12_H1:10212628..10212828 .	Vaccinium darrowii clone NJ8810/NJ8807 v1.2 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2016	McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-Jewel	LG5	N/A	42	Pr032754272c	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG07	N/A	66	Pr032754272	View
3	Blueberry-W85-23-2017	LG07	N/A	58.1	Pr032754272	View