|
|
Marker Overview
| Name | CA278 |
|---|
| Genbank ID | CF810581 |
|---|
| Type | EST marker |
|---|
| Species | Vaccinium corymbosum |
|---|
| Primer 1 | CA278.forward primer: CACCACCACCACTCAGTCAC |
|---|
| Primer 2 | CA278.reverse primer: CTCGCAGAAACAGTCCATCA |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | CF810581 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
| 2012 | Bell DJ, Drummond FA, Rowland LJ. Fine-scale spatial genetic structure associated with Vaccinium angustifolium Aiton (Ericaceae). International Journal of Modern Botany. 2012; 2(4):72-82. |
|
