|
Marker Overview
Name | CA278 |
Genbank ID | CF810581 |
Type | EST marker |
Species | Vaccinium corymbosum |
Primer 1 | CA278.forward primer: CACCACCACCACTCAGTCAC |
Primer 2 | CA278.reverse primer: CTCGCAGAAACAGTCCATCA |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | CF810581 |
Alignments
The following features are aligned
Publications
Year | Publication |
2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
2012 | Bell DJ, Drummond FA, Rowland LJ. Fine-scale spatial genetic structure associated with Vaccinium angustifolium Aiton (Ericaceae). International Journal of Modern Botany. 2012; 2(4):72-82. |
|