|
Marker Overview
Name | CA787F |
Genbank ID | CF810934 |
Type | SSR |
Species | Vaccinium corymbosum |
Repeat Motif | (GAA)7 |
Primer 1 | CA787F.forward primer: TCCTCGTTCTCTCCCTCTCA |
Primer 2 | CA787F.reverse primer: GTTTCGCTGAAGTTGGAGTCCTT |
Max Length | 270 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | CF810934 |
Publications
Year | Publication |
2006 | Boches P, Bassil N, Rowland L. Genetic Diversity in the Highbush Blueberry Evaluated with Microsatellite Markers. Journal of the American Society for Horticultural Science. 2006; 131(5):674-686. |
2005 | Boches P, Bassil N, Rowland L. Microsatellite markers for Vaccinium from EST and genomic libraries. Molecular ecology notes. 2005; 5(3):657-660. |
2016 | McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24. |
Alignments
The following features are aligned
|