|
Marker Overview
Name | VCBC06669 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Vaccinium corymbosum |
Repeat Motif | (tttc)3 |
Primer 1 | VCBC06669.forward primer: CATGAGTGGGGTAAGAAGAAGG |
Primer 2 | VCBC06669.reverse primer: CCCTACAGCATAAACGGGTTAG |
Max Length | 323 |
Publication | [view all] |
Publications
Year | Publication |
2012 | Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46. |
2016 | McCallum S, Graham J, Jorgensen L, Rowland L, Bassil N, Hancock J, Wheeler E, Vining K, Poland J, Olmstead J, Buck E, Wiedow C, Jaclson E, Allan B, Hackett C. Construction of a SNP and SSR linkage map in autotetraploid blueberry using genotyping by sequencing. Molecular Breeding. 2016; 36(41):1-24. |
Alignments
The following features are aligned
|