scf16i, scf16i (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf16i
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(ag)18
Primer 1	scf16i.forward primer: AGTTGCAAGGTCTGCTCCAT
Primer 2	scf16i.reverse primer: TTTCGATTACCGAACTTGCC
Max Length	239
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr10	supercontig	Vmac_chr10:17413647..17413893 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr10	supercontig	chr10:18972467..18972701 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2011	Georgi L, Herai RH, Vidal R, Falsarella Carazzolle M, Guimarães Pereira G, Polashock J, Vorsa N. Cranberry microsatellite marker development from assembled next-generation genomic sequence. Molecular breeding. 2011.