|
Marker Overview
Name | GVC-C634_272 |
Genbank ID | N/A |
Type | SSR |
Species | Vaccinium sp. |
Primer 1 | GVC-C634_272.Forward: GAGTGCATCCAGAATGAGCA |
Primer 2 | GVC-C634_272.Reverse: TTGGCCAATATGTCTAGGGC |
Max Length | 306 |
Publication | [view all] |
Contact | Brandon Schlautman
|
Publications
Year | Publication |
2018 | Schlautman B, Diaz-Garcia L, Covarrubias-Pazaran G, Schlautman N, Vorsa N, Polashock J, Ogden E, Brown A, Lin Y, Bassil N, Buck E, Wiedow C, McCallum S, Graham J, Iorizzo M, Rowland L, Zalapa J. Comparative genetic mapping reveals synteny and collinearity between the American cranberry and diploid blueberry genomes. Molecular breeding. 2018; 38(1):9. |
Alignments
The following features are aligned
|