Vac110686 | GDV

Marker Overview

Marker Overview


Name	Vac110686
Genbank ID	N/A
Type	SSR
Species	Vaccinium sp.
Primer 1	Vac110686.Forward: CACCACTCCAAGAGACAGAGA
Primer 2	Vac110686.Reverse: TGTTTGAGCTGATGTGCCTA
Publication	[view all]
Contact	Brandon Schlautman

Contact

Name

Details

Brandon Schlautman

First name:	Brandon
Last name:	Schlautman
Institution:	Department of Horticulture, University of Wisconsin-Madison
Address:	Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Dr. Madison, WI 53706, USA
Country:	USA
Email:	schlautman@wisc.edu
Last update:	Apr 2017

Publications


Year	Publication
2018	Schlautman B, Diaz-Garcia L, Covarrubias-Pazaran G, Schlautman N, Vorsa N, Polashock J, Ogden E, Brown A, Lin Y, Bassil N, Buck E, Wiedow C, McCallum S, Graham J, Iorizzo M, Rowland L, Zalapa J. Comparative genetic mapping reveals synteny and collinearity between the American cranberry and diploid blueberry genomes. Molecular breeding. 2018; 38(1):9.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10_x_W85-23-F1-2017	LG08	N/A	20.7	Vac110686	View
2	Blueberry-F1#10-2017	LG08	N/A	16.2	Vac110686	View
3	Blueberry-W85-23-2017	LG08	N/A	30.1	Vac110686	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff28	supercontig	VaccDscaff28:4496600..4496789 .