|
|
Marker Overview
| Name | GVC-C547 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Vaccinium sp. |
|---|
| Primer 1 | GVC-C547.Forward: GATGAAGGACGCTATCGAGG |
|---|
| Primer 2 | GVC-C547.Reverse: TCTAGATCCACCATCCCTGC |
|---|
| Publication | [view all] |
|---|
| Contact | Brandon Schlautman
|
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2018 | Schlautman B, Diaz-Garcia L, Covarrubias-Pazaran G, Schlautman N, Vorsa N, Polashock J, Ogden E, Brown A, Lin Y, Bassil N, Buck E, Wiedow C, McCallum S, Graham J, Iorizzo M, Rowland L, Zalapa J. Comparative genetic mapping reveals synteny and collinearity between the American cranberry and diploid blueberry genomes. Molecular breeding. 2018; 38(1):9. |
|
