scaf00208 | GDV

Marker Overview

Marker Overview


Name	scaf00208
Genbank ID	N/A
Type	SSR
Species	Vaccinium sp.
Primer 1	scaf00208.Forward: TGGTGTAGAGGAATAAGCCAGTC
Primer 2	scaf00208.Reverse: CCAAACACCTGATACACAATGG
Publication	[view all]
Contact	Brandon Schlautman

Contact

Name

Details

Brandon Schlautman

First name:	Brandon
Last name:	Schlautman
Institution:	Department of Horticulture, University of Wisconsin-Madison
Address:	Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Dr. Madison, WI 53706, USA
Country:	USA
Email:	schlautman@wisc.edu
Last update:	Apr 2017

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold00208	supercontig	scaffold00208:2836..3107 .	Vaccinium corymbosum W8520 draft genome sequence	GDV marker alignment to genome using primer sequences
Vmac_chr12	supercontig	Vmac_chr12:39143993..39144259 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr12	supercontig	chr12:38171905..38172157 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2018	Schlautman B, Diaz-Garcia L, Covarrubias-Pazaran G, Schlautman N, Vorsa N, Polashock J, Ogden E, Brown A, Lin Y, Bassil N, Buck E, Wiedow C, McCallum S, Graham J, Iorizzo M, Rowland L, Zalapa J. Comparative genetic mapping reveals synteny and collinearity between the American cranberry and diploid blueberry genomes. Molecular breeding. 2018; 38(1):9.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	4.3	scaf00208	View
2	Blueberry-W85-23-2017	LG12	N/A	0	scaf00208	View